View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19433_high_5 (Length: 352)

Name: NF19433_high_5
Description: NF19433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19433_high_5
NF19433_high_5
[»] chr3 (2 HSPs)
chr3 (19-194)||(11749558-11749733)
chr3 (240-310)||(11749767-11749837)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 11749558 - 11749733
Alignment:
19 ctttcagttccactttcattgctaacgatataatcaggcaatggattttgattctctatcatttctttcctctaatcatcgtcatcagtgacgtcactga 118  Q
    ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
11749558 ctttcagttccactttcattgctaacgatataaccaagcaatggattttgattctctatcatttctttcctctgatcatcgtcatcagtgacgtcactga 11749657  T
119 taacgatgatgttgttatattcgaaaccgtgaccatgttgttgttgggttatagaagctacattgctgagtggagg 194  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
11749658 taacgatgatgttgttatattcgaaaccgtggccatgttgttgttgggttatagaagctacattgctgagtggagg 11749733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 240 - 310
Target Start/End: Original strand, 11749767 - 11749837
Alignment:
240 ttgtttttggttggtattggaattttcggttcttgggtccattttcttctgttcttgctttcccgcgtgaa 310  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
11749767 ttgtttttggttggtattggaattttcagttcttgggtccattttcttctgttcttgctttcccgcgtgaa 11749837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University