View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19433_high_5 (Length: 352)
Name: NF19433_high_5
Description: NF19433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19433_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 11749558 - 11749733
Alignment:
| Q |
19 |
ctttcagttccactttcattgctaacgatataatcaggcaatggattttgattctctatcatttctttcctctaatcatcgtcatcagtgacgtcactga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11749558 |
ctttcagttccactttcattgctaacgatataaccaagcaatggattttgattctctatcatttctttcctctgatcatcgtcatcagtgacgtcactga |
11749657 |
T |
 |
| Q |
119 |
taacgatgatgttgttatattcgaaaccgtgaccatgttgttgttgggttatagaagctacattgctgagtggagg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11749658 |
taacgatgatgttgttatattcgaaaccgtggccatgttgttgttgggttatagaagctacattgctgagtggagg |
11749733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 240 - 310
Target Start/End: Original strand, 11749767 - 11749837
Alignment:
| Q |
240 |
ttgtttttggttggtattggaattttcggttcttgggtccattttcttctgttcttgctttcccgcgtgaa |
310 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11749767 |
ttgtttttggttggtattggaattttcagttcttgggtccattttcttctgttcttgctttcccgcgtgaa |
11749837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University