View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19434_high_4 (Length: 542)
Name: NF19434_high_4
Description: NF19434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19434_high_4 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-125; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 265 - 524
Target Start/End: Complemental strand, 38210551 - 38210292
Alignment:
| Q |
265 |
gggtatagtgtaagacattgtgtgcttagttgcacgtttggtgaccatagacgtgtacttgcaggtttaacgaggcaattttaccgtgatttcaagaagc |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
38210551 |
gggtatagtgtaagacattgtgtgcttagttgcacgtttggtgacaagagacgtgtacttgcaggtttaactaggcaattttaccgtgattttaagaagt |
38210452 |
T |
|
| Q |
365 |
tacaaaatgaaacttctatgttaacgtggaaatttcaccttggttttctgaaaacacataagtttcgccacggaaccacatcgaggcatacacaaatgac |
464 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38210451 |
tacaaaatgaagcttctatgttaacgtggaaatttcaccttggttttctgaaaacacataagtttcgccacggaaccacaccgaggcatacacaaatgac |
38210352 |
T |
|
| Q |
465 |
aattgttgacttgtaactctagttagggtggattgatagtaaatatgaatatgatattgg |
524 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38210351 |
aatttttgacttgtaactctagttagggtggattgatagtaaatatgaatatgatattgg |
38210292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 85 - 144
Target Start/End: Complemental strand, 38210726 - 38210667
Alignment:
| Q |
85 |
taaagtataacctccaaaagtaatcattccgttttataagtgtctcgttcaaaagaattc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38210726 |
taaagtataacctccaaaagtaatcattctgttttataagtgtctcgttcaaaagaattc |
38210667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 39 - 85
Target Start/End: Complemental strand, 38211945 - 38211899
Alignment:
| Q |
39 |
caggaagtttacgatttttaagttgagtactcgagactataaagtat |
85 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38211945 |
caggaagtttgcgattttcaagttgagtactcgagactataaagtat |
38211899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 206 - 244
Target Start/End: Complemental strand, 38210604 - 38210566
Alignment:
| Q |
206 |
gtaacgtcattcttactaattaaaacgggtatttgtacc |
244 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38210604 |
gtaatgtcattcttactaattaaaacgggtatttgtacc |
38210566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 379
Target Start/End: Original strand, 69298 - 69327
Alignment:
| Q |
350 |
gtgatttcaagaagctacaaaatgaaactt |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
69298 |
gtgatttcaagaagctacaaaatgaaactt |
69327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 379
Target Start/End: Complemental strand, 40896986 - 40896957
Alignment:
| Q |
350 |
gtgatttcaagaagctacaaaatgaaactt |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40896986 |
gtgatttcaagaagctacaaaatgaaactt |
40896957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University