View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19434_low_15 (Length: 338)
Name: NF19434_low_15
Description: NF19434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19434_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 42970103 - 42970284
Alignment:
| Q |
16 |
tatacttgtgcctattgaagacttactctcattaaagaggttgacgtcttctgataaaatgttttttcatatgaatcaattaattaaggattgaaccatc |
115 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42970103 |
tatatttgtgtctattgaagacttactctcattaaagaggttgacgtcttctggtaaa-tgttttttcatatgaatcaattaattaaggattgaaccatg |
42970201 |
T |
 |
| Q |
116 |
gaccaaacaagtatggagctactactacttttatcaatgtataaatatagtaagaaaagaaatgaaggtaatatgagaaccac |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42970202 |
gaccaaacaagtatggagctacttctacttttatcaatgtataaatatagtaagaaaagaaatgaaggtaatatgagaaccac |
42970284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 255 - 328
Target Start/End: Original strand, 42970315 - 42970388
Alignment:
| Q |
255 |
acagttttatgtgaacactgtactacgttgttcaataatggcaccatgtgactatagtatagtttcatttcatc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42970315 |
acagttttatgtgaacactgtactacgttgttcaataatggcaccatgtgactatagtatagtttcatttcatc |
42970388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University