View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19434_low_24 (Length: 279)
Name: NF19434_low_24
Description: NF19434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19434_low_24 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 279
Target Start/End: Complemental strand, 4006530 - 4006264
Alignment:
| Q |
13 |
aatatgttatataagaggaatctctttgtgattannnnnnnatagattgaaaatcagcaatgatatgaagtattgcatatttatttgtattagtagtaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4006530 |
aatatgttatataagaggaatctctttgtgattatttttttatagattgaaaatcagcaatgatatgaagtattgcatatttatttgtattagtagtaat |
4006431 |
T |
|
| Q |
113 |
actacttttcctctactctttattctgcgaatttacatctctcgttcaattggagataatcttatttgagaagcatgttcaccgcattgtggacattgga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4006430 |
actacttttcctctactctttattctgcaaatttacatcactcgttcaattggagataatcttatttgagaagcatgttcaccgcattgtggacattgga |
4006331 |
T |
|
| Q |
213 |
ttaattggttaacgtttactagtcgaacatcgaacgataaaacatgtgtaggaattcgagcaggtca |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4006330 |
ttaattggttaacgtttactagtcgaacatcgaaagataaaacatgtgtaggaattcgagcaggtca |
4006264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 54 - 100
Target Start/End: Complemental strand, 4018650 - 4018605
Alignment:
| Q |
54 |
atagattgaaaatcagcaatgatatgaagtattgcatatttatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
4018650 |
atagattgaaaatcagcaatgatatg-agtatttcatatttatttgt |
4018605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University