View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19434_low_25 (Length: 278)
Name: NF19434_low_25
Description: NF19434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19434_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 265
Target Start/End: Complemental strand, 4554497 - 4554249
Alignment:
| Q |
17 |
acaatttagaaaatgtaaacaatatcaaatctcacacaacattcaacagtgtaagatattgtctagtataccaaagaaaactttttaccttaatggtttt |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4554497 |
acaatttagaaaatctaaacaatatcaaatctaacacaacattcaacagtgtaagatattgtctagtataccaaagaaaactttttaccttaatggtttt |
4554398 |
T |
|
| Q |
117 |
taacgagtgttttctaagatggtgtaattttttctcaacttccaaaaccttctgtcttgagaacgagtcatcattgttagtaccataaactgtaatgcaa |
216 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4554397 |
taatgagtgttttctaagatgctgtaattttttctcaacttccaaaaccttctgtcttgagaacgagtcatcattgttagtaccataaactgtaatgcaa |
4554298 |
T |
|
| Q |
217 |
agcaccaagagcatgaatattactttggatcccatggctaaagaataat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4554297 |
agcaccaagagcatgaatattactttggatcccatggctaaagaataat |
4554249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University