View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19434_low_27 (Length: 269)
Name: NF19434_low_27
Description: NF19434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19434_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 37565618 - 37565873
Alignment:
| Q |
1 |
gtcctctcttcgtggactagaattttgtacccaatgctgactcaatgacataataactcataaagctttt-cttatcataaactacattacatgcatgag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| || |
|
|
| T |
37565618 |
gtcctctcttcgtggactagaattttgtacccaatgctgactcaatgacataataactca--aagctttttcttatcataaactacattacatg----ag |
37565711 |
T |
 |
| Q |
100 |
agggtgggaggaaaagtagcactgtacttcattaccttatactctatcatttcgttgtctccttaatcaatgtcagttacatgttttgtggagtagtaag |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37565712 |
agggtgggaggaaaagtagtactgtacttcattaccttatactctatcatttcgttgtctccttagtcaatgtcagttacatgttttgtggagtagtaag |
37565811 |
T |
 |
| Q |
200 |
tatttaacatgtagctgttggctctctatatgaattctgcatctctttttaaacagtataat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37565812 |
tatttaacatgtagctgttggctctctatatgaattctgcatctctttttaaacagtataat |
37565873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University