View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19434_low_31 (Length: 201)

Name: NF19434_low_31
Description: NF19434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19434_low_31
NF19434_low_31
[»] chr1 (2 HSPs)
chr1 (1-85)||(32244450-32244534)
chr1 (1-85)||(32250159-32250243)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 32244450 - 32244534
Alignment:
1 tgaatgagaacaaatgtatatggcatgggatggtcccatgcattctgcgtcgattctttacatgttgatatcattacttcttttt 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32244450 tgaatgagaacaaatgtatatggcatgggatggtcccatgcattctgcgtcgattctttacatgttgatatcattacttcttttt 32244534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 32250159 - 32250243
Alignment:
1 tgaatgagaacaaatgtatatggcatgggatggtcccatgcattctgcgtcgattctttacatgttgatatcattacttcttttt 85  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32250159 tgaatgagaacaaatatatatggcatgggatggtcccatgcattctgcgtcgattctttacatgttgatatcattacttcttttt 32250243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University