View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19435_high_2 (Length: 353)
Name: NF19435_high_2
Description: NF19435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19435_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 19 - 343
Target Start/End: Complemental strand, 36943161 - 36942837
Alignment:
| Q |
19 |
gaacttgtttattccaaatgcatcctcattgacctttaatttcactagctttgacccgaatgacaaaagcataatctatgaaggatcagcaaatcctgct |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36943161 |
gaacttgtttattccaaatgcatcttcattgacctttaatttcactagctttgacccgaatgacaaaagcataatctatgaaggatcagcaaatcctgct |
36943062 |
T |
 |
| Q |
119 |
tcatcagctatccaacttacaatcaactatggaagcattggtagagccacatattaccaacctatccatctttggaacaaaatcacaaacaatctcacag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36943061 |
tcatcagctatccaacttacaatcaactatggaagcattggtagagccacatattaccaacctatccatctttggaacaaaatcacaaacaatctcacag |
36942962 |
T |
 |
| Q |
219 |
atttcacatctcatttcacatttacaatagattcacagaatagacaaatgtatggagatgggattgcattcttcctagccccttatggttcaaaaaagcc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942961 |
atttcacatctcatttcacatttacaatagattcacagaatagacaaatgtatggagatgggattgcattcttcctagccccttatggttcaaaaaagcc |
36942862 |
T |
 |
| Q |
319 |
taatgcaacaaaaggtggtcctatg |
343 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
36942861 |
taatgcaacaaaaggtggttctatg |
36942837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 147 - 182
Target Start/End: Original strand, 12895708 - 12895743
Alignment:
| Q |
147 |
atggaagcattggtagagccacatattaccaaccta |
182 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12895708 |
atggaagtattggtagagccacatattaccaaccta |
12895743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University