View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19435_high_7 (Length: 250)
Name: NF19435_high_7
Description: NF19435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19435_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 233
Target Start/End: Original strand, 4818824 - 4819041
Alignment:
| Q |
16 |
taatactcggtttgcgaaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctttgtaacctgggttctagtatactcaaatgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4818824 |
taatactcggtttgcgaaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctttgtaacctgggttctagtatactcaaatgc |
4818923 |
T |
 |
| Q |
116 |
gctttattaccgagtagccctttacacacgtcagtagccagcagcgcccttgtatcactggtatattttcttgaatgcaaatcctaaagcaactatcttc |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
4818924 |
gctttattaccgagtagcccttaacacacgtcagtagccagcagcgcccttgtatcactggtatcttttcttgaaggaaaatcctaaagcaactatcttc |
4819023 |
T |
 |
| Q |
216 |
ttgttagaaaatttgtta |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4819024 |
ttgttagaaaatttgtta |
4819041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 4845208 - 4845260
Alignment:
| Q |
32 |
aaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctt |
85 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
4845208 |
aaaaaatacttggctaa-ttgattcatccacaaatccctttgtatttgatcctt |
4845260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University