View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19435_low_5 (Length: 270)
Name: NF19435_low_5
Description: NF19435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19435_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 4818736 - 4818476
Alignment:
| Q |
1 |
ttcaggggcggttgagttgatgcacatttcttggagacaggtaaggcaggttttgctttagaaggtggtgcaggagcagaagcagctgctgatgggggtt |
100 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4818736 |
ttcaggggcggttgaattgatgcgcatttcttggagacaggtaaggcaggttttgcttttgaaggtggtgcaggagcagaagcagctgctgatgggggtt |
4818637 |
T |
 |
| Q |
101 |
gcaatgaaagaagtgtcggataatacaatggtggtgctgcttgcgacatagccgtggctggtggaggctggaaatcttcgatttttcttatcacgagttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4818636 |
gcaatgaaagaagtgtcggataatacaatggtggtgctgcttgcggcatagccgtggctggtggaggctggaaatcttcgatttttcttatcacgagttc |
4818537 |
T |
 |
| Q |
201 |
ataatctgattgctatagttgcagctccacagtatctcttatcactttattttatctttcc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4818536 |
ataatctgattgctatagttgcagctccactgtatctcttatcactttattttatctttcc |
4818476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 110 - 240
Target Start/End: Complemental strand, 4865490 - 4865360
Alignment:
| Q |
110 |
gaagtgtcggataatacaatggtggtgctgcttgcgacatagccgtggctggtggaggctggaaatcttcgatttttcttatcacgagttcataatctga |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||| || |
|
|
| T |
4865490 |
gaagtgtcggatagtacaatggtggtgctgattgcggcatagccgtggctggtggaggctgcaaagcttctttttttcttatcacgagttcataatcaga |
4865391 |
T |
 |
| Q |
210 |
ttgctatagttgcagctccacagtatctctt |
240 |
Q |
| |
|
||||| |||||||||||||||| |||||||| |
|
|
| T |
4865390 |
ttgctttagttgcagctccacaatatctctt |
4865360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 9 - 170
Target Start/End: Complemental strand, 4814697 - 4814534
Alignment:
| Q |
9 |
cggttgagttgatgcacatttcttggagacaggtaaggcaggttttgctttagaaggtggtgcaggagcagaagcagctgc---tgatgggggttgcaat |
105 |
Q |
| |
|
|||||||| |||||| | |||||||| | ||||||||| |||| |||||||||||||||||||||||||||||| |||||| || ||| |||||| | |
|
|
| T |
4814697 |
cggttgagatgatgcccttttcttgggg-caggtaaggtaggtgttgctttagaaggtggtgcaggagcagaaggagctgccgatggtggtggttgcgac |
4814599 |
T |
 |
| Q |
106 |
gaaagaagtgtcggataatacaatggtggtgctgcttgcgacatagccgtggctggtggaggctg |
170 |
Q |
| |
|
| ||||||||||||||||||| ||| ||||| |||| ||||| || |||||| || |||||| |
|
|
| T |
4814598 |
aagttaagtgtcggataatacaatagtgatgctgattgcaacataaccatggctgatgaaggctg |
4814534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 185 - 240
Target Start/End: Complemental strand, 4811951 - 4811897
Alignment:
| Q |
185 |
ttcttatcacgagttcataatctgattgctatagttgcagctccacagtatctctt |
240 |
Q |
| |
|
||||||||||||||||| |||| ||||||| |||||| ||||||||| |||||||| |
|
|
| T |
4811951 |
ttcttatcacgagttca-aatcagattgctttagttgtagctccacaatatctctt |
4811897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 237
Target Start/End: Complemental strand, 4814530 - 4814480
Alignment:
| Q |
187 |
cttatcacgagttcataatctgattgctatagttgcagctccacagtatct |
237 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| | ||||||||||||||| |
|
|
| T |
4814530 |
cttatcaagagttcataatctgattgctttagaagtagctccacagtatct |
4814480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University