View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19436_high_2 (Length: 349)
Name: NF19436_high_2
Description: NF19436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19436_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 16 - 332
Target Start/End: Complemental strand, 3920332 - 3920017
Alignment:
| Q |
16 |
ggtaacactgcaagttctcgacaccaacctcgacacaaacgatccaacaggttttgtgtttaactatacagtttgtttctttgtttgttcaaattgttgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3920332 |
ggtaacactgcaagttctcgacaccaacctcgacacaaacgatccaacaggttttgtgtttaactatacagtttgtttctttgtttgttcaaattgttgt |
3920233 |
T |
|
| Q |
116 |
aaatatattgtttatcatgttttttaaagtgcttgtttggtatcatacttgagtttggcgcttcaacaaaatcatgtgtcaccgtgataccaaacatgct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3920232 |
aaatatattgtttatcatgttttttaaagtgcttgtttggtatcatact-gagtttggcgctgcaacaaaatcatgtgtcaccgtgataccaaacatgct |
3920134 |
T |
|
| Q |
216 |
agacaaattgaggttatcatttttgtattgcttcattataatatggcatagcatttgtgcgtgtgtgcgcgcgtgcatttttcagtgcttctgataggaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3920133 |
agacaaattgaggttatcatttttgtattgcttcattataatatggcatagcatttgtgcgtgtgtgcgcgcgtgcatttttcagtgcttctgataggaa |
3920034 |
T |
|
| Q |
316 |
ctcgaaattctcaagag |
332 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3920033 |
ctcgaaattctcaagag |
3920017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University