View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19437_high_6 (Length: 318)
Name: NF19437_high_6
Description: NF19437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19437_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 46730710 - 46730408
Alignment:
| Q |
1 |
aaatgattgtttgtaggcttgatgctcagtaggtggagaannnnnnngagcagcatctatgaagtatgcttactagttttgaatgagacacagcgttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46730710 |
aaatgattgtttgtaggcttgatgctcagtaggtggagaatttttttgagcagcatctatgaagtatgcttactagttttgaatgagacacagcgttaaa |
46730611 |
T |
|
| Q |
101 |
tttgtaatctgaagtaatttaatattctgtatgacttgtgatgaagtttattgatatgtctacattattaattagtttattgcctaaattttccgtgcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46730610 |
tttgtaatctgaagtaatttaatattctgcatgacttgtgatgaagtttattgatatgtctacattattaattagtttattgcctaaattttccgtgcaa |
46730511 |
T |
|
| Q |
201 |
tgtattcttttctatatttggttaggtaggggaaactaccggcaacattgaagaaagctgtgtaacctttgcaactcgtgccttgggattgacaacccct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46730510 |
tgtattcttttctatatttggttaggtaggggaaactactggcaacattgaagaaagctgtgtaacctttgcaactcgtgccttgggattgacaacccct |
46730411 |
T |
|
| Q |
301 |
ttg |
303 |
Q |
| |
|
||| |
|
|
| T |
46730410 |
ttg |
46730408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 243 - 303
Target Start/End: Complemental strand, 7926623 - 7926563
Alignment:
| Q |
243 |
caacattgaagaaagctgtgtaacctttgcaactcgtgccttgggattgacaacccctttg |
303 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7926623 |
caacattgaagaaagttgtgcaacctttgcaactcgtgccttgggattgacaacacctttg |
7926563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University