View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19437_low_7 (Length: 334)
Name: NF19437_low_7
Description: NF19437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19437_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 177 - 314
Target Start/End: Original strand, 4359036 - 4359173
Alignment:
| Q |
177 |
acaaaacttgatgtctcattggcatctacttcggttgccgctccaactttttctaatgcaaaagcctgtctaaacaactatgcaattgttgaagctttga |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4359036 |
acaaaacttgatgtctcattggcatctacttcggttgccgctccaactttttctaatgcaaaagcctgtctaaacaactatgcaattgttgaagctttga |
4359135 |
T |
 |
| Q |
277 |
atttcacaaattaattccaactcttttttcttaattag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4359136 |
atttcacaaattaattccaactcttttttcttaattag |
4359173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 43 - 115
Target Start/End: Original strand, 4358901 - 4358974
Alignment:
| Q |
43 |
gcagccgatttggttcacgtttaaatgtaaaaataaataaattgtgatcctttgtttatag-taaagggaattc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
4358901 |
gcagccgatttggttcacgtttaaatgtaaaaataaataaattgcgatcctttgcttatagaaaaagggaattc |
4358974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University