View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_high_35 (Length: 297)
Name: NF19438_high_35
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_high_35 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 297
Target Start/End: Complemental strand, 3294996 - 3294718
Alignment:
| Q |
19 |
taagatcgtctgctatcaactagctaatcagttatccattacnnnnnnnnaccaaacagattttaaataaagtctaaacatttcattacctgtggcctag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3294996 |
taagatcgtctgctatcaactagctaatcagttatccattactcttttttaccaaacagattttaaacaaagtctaaacatttcattacctgtggcctag |
3294897 |
T |
|
| Q |
119 |
gtcttcttggtctagaccttctaaacttctgcaaattactcgcattagcaacaccaagaacagcagattcatacgtagcaaaattccccaccattctctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294896 |
gtcttcttggtctagaccttctaaacttgtgcaaattactcgcattagcaacaccaagaacagcagattcatacgtagcaaaattccccaccattctctt |
3294797 |
T |
|
| Q |
219 |
ctcagactccaacccaacatatgcctcaaccctattcaccactgcctcacccacccactgaaccgaattaaacaacaac |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294796 |
ctcagactccaacccaacatatgcctcaaccctattcaccactgcctcacccacccactgaaccgaattaaacaacaac |
3294718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University