View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19438_high_40 (Length: 280)

Name: NF19438_high_40
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19438_high_40
NF19438_high_40
[»] chr4 (1 HSPs)
chr4 (64-265)||(54950224-54950425)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 64 - 265
Target Start/End: Complemental strand, 54950425 - 54950224
Alignment:
64 ctacaattgtgtttagtgctgctacgtgaattttcccatatatacgattctgcattgttgcgtttaaatgttcatgatttacttcataattcgcgttata 163  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
54950425 ctacaattgtgttttgtgctgctacgtgaattttcccatatatacgattctgcattgttgcgtttaaatgttcatgatttactgcataattcgcgttata 54950326  T
164 ggttggtttataagtgtatctggtttatgcatttctgcatagctacgattttctgcgctattacgagtgtggtcaagtctactatgtcgtcgcttactga 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
54950325 ggttggtttataagtgtatctggtttatgcatttctgcatagctacgattttctgcgctattacgagtgtggtcaagtctactatgtcgtcgcttgctga 54950226  T
264 tg 265  Q
    ||    
54950225 tg 54950224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University