View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_high_45 (Length: 267)
Name: NF19438_high_45
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 253
Target Start/End: Original strand, 75127 - 75368
Alignment:
| Q |
12 |
tcatcaataagtgaagggtttaannnnnnnacagccagtacctgannnnnnnnaaaaagtatatggtttaggttttccctcagttcagaagtaattaatt |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75127 |
tcatcaataagtgaagggtttaatttttttacagccagtacctgattttttttaaaaagtatatggtttaggttttccctcagttcagaagtaattaatt |
75226 |
T |
|
| Q |
112 |
ttacttttttaatttaactgcagcctaacccaataagcgttaaattttagtttagacatttttgaacacaattcagacatgaacacaggtgtcatatttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75227 |
ttacttttttaatttaactgcagcctaacccaataagcgttaaattttagtttagacatttttgaacacaattcagacatgaacacaggtgtcatatttg |
75326 |
T |
|
| Q |
212 |
catatgtcatggacatcttatgaatatgtcatggacatacat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75327 |
catatgtcatggacatcttatgaatatgtcatggacatacat |
75368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University