View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_high_52 (Length: 250)
Name: NF19438_high_52
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_high_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 55 - 161
Target Start/End: Complemental strand, 45111212 - 45111106
Alignment:
| Q |
55 |
taaaatgatctcttcgaattgaatacttactttaaggaaaagtatacttcaaagtcataagataactcaacccaaacaactcaaccaagttagtttaatc |
154 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45111212 |
taaaatgatctcttcgaattaaatacttactttaagaaaaaatacacttcaaagtcacaagataactcaacccaaacaactcaaccaagttagtttaatc |
45111113 |
T |
 |
| Q |
155 |
cacttaa |
161 |
Q |
| |
|
||||||| |
|
|
| T |
45111112 |
cacttaa |
45111106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University