View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19438_high_66 (Length: 223)

Name: NF19438_high_66
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19438_high_66
NF19438_high_66
[»] chr3 (1 HSPs)
chr3 (14-209)||(29068856-29069051)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 29068856 - 29069051
Alignment:
14 cagagacggagtagacggggcgtgcggctatggtgacactcacagagacggttatggcatcaccggtgctgctgctctcagtgagactctctttgtgcgt 113  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29068856 cagagacggagtagacggggcgtgcggctacggtgacactcacagagacggttatggcatcaccggtgctgctgctctcagtgagactctctttgtgcgt 29068955  T
114 ggtcagatctgtggcgggtgctttgagctacgatgtctggaagaggatgttccgtttgataagcggtggtgtgtttcgggtagttctgttgttgtt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29068956 ggtcagatctgtggcgggtgctttgagctacgatgtctggaagaggatgttccgtttgataagcggtggtgtgtttcgggtagttctgttgttgtt 29069051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University