View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_high_67 (Length: 219)
Name: NF19438_high_67
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_high_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 21700198 - 21700014
Alignment:
| Q |
19 |
ggtacctggaaactaaaggctccctcaaaaattcagagttttatatggtggacttgtcgtggttgtctaccaacaagagttcggttacaaaataaggaag |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21700198 |
ggtacctggaaactaaaggctcccccaaaaattcagagttttatatggtgcacttgtcgtggttgtctaccaacaagagttcgattacaaaataaggaaa |
21700099 |
T |
|
| Q |
119 |
tgcattgtcctgttaattgtatcagttgtaacgactctgtagaggatgcagtacatgttttatttcaatgcccttttgcagttca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21700098 |
tgcattgtcctgttaattgtatcagttgtaacgactccgtagaggatgcagtacatgttttatttcaatgcccttttgcagttca |
21700014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University