View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_25 (Length: 375)
Name: NF19438_low_25
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 106 - 360
Target Start/End: Complemental strand, 51310703 - 51310449
Alignment:
| Q |
106 |
cgtccccgtccctatcgtttcaaacacagccaaccaatatcagacagaatagtaagagccctccgtcacggtctccgtctcctccaccgttccggctcca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310703 |
cgtccccgtccctatcgtttcaaacacagccaaccaatatcagacagaatagtaagagccctccgtcacggtctccgtctcctccaccgttccggctcca |
51310604 |
T |
 |
| Q |
206 |
ccttcttcatcttcggcgcaaccggtaacgtctacacagtaaccttatcttccacaccctcgtgcacgtgcccggaccggacaataccatgcaaacacat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51310603 |
ccttcttcatcttcggcgcaaccggtaacgtctacacagtaaccttatcttccacaccctcgtgcacgtgcccggaccggacaacaccatgcaaacacat |
51310504 |
T |
 |
| Q |
306 |
cctcttcgttatgattcgagtattaggcgtttcacaaaacgacgcttgtgtccgt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310503 |
cctcttcgttatgattcgagtattaggcgtttcacaaaacgacgcttgtgtccgt |
51310449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 51310802 - 51310748
Alignment:
| Q |
1 |
ctatattcttcacacaaaaccgttcctcattctttggaaatggagtctgttgcct |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310802 |
ctatattcttcacacaaaaccgttcctcattctttggaaatggagtctgttgcct |
51310748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University