View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_29 (Length: 351)
Name: NF19438_low_29
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Original strand, 2951907 - 2952242
Alignment:
| Q |
1 |
gtgcaaagcatatgtaggtggcaggtccacttcatagagatctcctacttcatgttacaccaactgatgccatcatgccatgggttcactttgatgagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2951907 |
gtgcaaagcatatgtaggtggcaggtccacttcatagagatctcctacttcatgttacaccaactgatgccatcatgccatgggttcactttgatgagtt |
2952006 |
T |
 |
| Q |
101 |
taattatggatattaatgtttaattatggatattaacgttaaactcaggatttgatgacgcagagagggaggtgtcgttatcaatatgttacccagtttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2952007 |
taattatggatattaatgtttaattatggatattaacgttaaactcaggatttgatgacgcagagagggaggtgtcgttatcaatatgttgcccagtttc |
2952106 |
T |
 |
| Q |
201 |
tattcagaattttattcaccatgatttgatcatcagaattacatatgcttgttcaaaataatttttcttatccccaccattgggttgctttttgcaattg |
300 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2952107 |
tattcagaattctattcaccatgatttgatcatcagaattacatatgcttgttcaaaataatttttcttctccccaccattgggttgctttttgcaattg |
2952206 |
T |
 |
| Q |
301 |
tgtctcattcaggataaatgtcatttgatagataat |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2952207 |
tgtctcattcaggataaatgtcatttgatagataat |
2952242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University