View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_32 (Length: 336)
Name: NF19438_low_32
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_32 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0019 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 6 - 336
Target Start/End: Complemental strand, 40218 - 39888
Alignment:
| Q |
6 |
agagagatgaacttagaaagagcgcggtttggttcaaattggttagacagttggatggaagaaaacacatggagccaaaccggcgacacttcatcgaaaa |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40218 |
agagacatgaacttagaaagagcgcggtttggttcaaattggttagacagttggatggaagaaaacacatggagccaaaccggcgacacttcatcgaaaa |
40119 |
T |
 |
| Q |
106 |
atgtaaatgatgatgagaagagtgacaaaattcttgaagtagatacttggaaaccacgtttgaaatcacaacatagtactagcacttcttttcaacatca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40118 |
atgtaaatgatgatgagaagagtgacaaaattcttgaagtagatacttggaaaccacatttgaaatcacaacatagtactagcacctcttttcaacatca |
40019 |
T |
 |
| Q |
206 |
ttattcatcttctgattacaataatgaaaatttgatggtacaagattcgccgtcaaaacgttcttctaaagcttataatccaagtctctcttctatgaag |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40018 |
ttattcatcttctgattacaataatgaaaatttgatggtacaagattcgccgtcaaaacgttcttctaaagcttataatccaagtctctcttctatgaag |
39919 |
T |
 |
| Q |
306 |
catcagaaaggaaaagaagaagaagtagctt |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39918 |
catcagaaaggaaaagaagaagaagtagctt |
39888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University