View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_41 (Length: 280)
Name: NF19438_low_41
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 64 - 265
Target Start/End: Complemental strand, 54950425 - 54950224
Alignment:
| Q |
64 |
ctacaattgtgtttagtgctgctacgtgaattttcccatatatacgattctgcattgttgcgtttaaatgttcatgatttacttcataattcgcgttata |
163 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54950425 |
ctacaattgtgttttgtgctgctacgtgaattttcccatatatacgattctgcattgttgcgtttaaatgttcatgatttactgcataattcgcgttata |
54950326 |
T |
|
| Q |
164 |
ggttggtttataagtgtatctggtttatgcatttctgcatagctacgattttctgcgctattacgagtgtggtcaagtctactatgtcgtcgcttactga |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54950325 |
ggttggtttataagtgtatctggtttatgcatttctgcatagctacgattttctgcgctattacgagtgtggtcaagtctactatgtcgtcgcttgctga |
54950226 |
T |
|
| Q |
264 |
tg |
265 |
Q |
| |
|
|| |
|
|
| T |
54950225 |
tg |
54950224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University