View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_45 (Length: 269)
Name: NF19438_low_45
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 254
Target Start/End: Complemental strand, 31582043 - 31581799
Alignment:
| Q |
10 |
ataattctctaacttctccgcgtagtatccgtgttaagggtcatatctatcccttaataatacgacaaccacgcaacccacaaaggttcaattcttagga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31582043 |
ataattctctaacttctccgcgtagtatccgtgttaagggtcatatctatcccttaataatacgacaaccacgcaacccacaaaggttcaattcttagga |
31581944 |
T |
 |
| Q |
110 |
ggttaatgtacattttgtannnnnnngtgatctttctttatgtgtctagacattaattattgttatcaaagttacgtcactagctgttgcattcaaatcc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31581943 |
ggttaatgtacattttgtatttttttgtgatctttctttatgtgtctagacattaattattgttatcaaagttacgtcactagctgttgcattcaaatcc |
31581844 |
T |
 |
| Q |
210 |
aatggatattttcccggaaagattagtttcattatacttcaatgt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31581843 |
aatggatattttcccggaaagattagtttcattatacttcaatgt |
31581799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University