View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_47 (Length: 265)
Name: NF19438_low_47
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 37 - 254
Target Start/End: Complemental strand, 40909131 - 40908912
Alignment:
| Q |
37 |
tcataactttataatatacaaataatacaatgaagcatgttacatctaaaaacaaatcatacactacag-aacagtaatcgttcctttttaaagtgattc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40909131 |
tcataactttataatatacaaataatacaatgaagcatgttacatctaaaaacaaatcatacactacaggaacagtaatcgttcctttttaaagtgattc |
40909032 |
T |
 |
| Q |
136 |
ggttcaaatcaatccctatcttatctctaggttcaaccagtacaaggaatttgtgatttcccaagctgtctctaactgtgcaagcc-ccccgcgccactc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
40909031 |
ggttcaaatcaatccctatcttatctctaggttcaaccagtacaaggaatttgtgatttctcaagccgtctctaactgtgcaagcccccccgcgccactc |
40908932 |
T |
 |
| Q |
235 |
tctctgttatgtccctctct |
254 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
40908931 |
tctctgttatttccctctct |
40908912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 40917311 - 40917278
Alignment:
| Q |
1 |
cttctggtttttcctacttttggccacgttgatt |
34 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
40917311 |
cttctggtttttcctacttttggccatgttgatt |
40917278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University