View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_48 (Length: 262)
Name: NF19438_low_48
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 7476984 - 7476750
Alignment:
| Q |
17 |
catctctatcactgttacgatcatttgggaatattatatgctgccattagagttt-ataacatgcatgtgttgatcttattcgacaccatattttatttc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7476984 |
catctctatcactgttacgatcatttgggaatattatatgctgccattagagttttataacatgcatgtgttgatcttattcgacaccatattttatttc |
7476885 |
T |
|
| Q |
116 |
ttgaattctttaatggcaacgcggcaattcttgcattcattattagttgatgtgtcaattacatgtcctctaataaaaacatgcataccnnnnnnnnaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7476884 |
ttgaattctttaatggcaacgcggcaattcttgcattcattattagttgatgtgtcaattacatgtcctctaataaaaacatgcatacc-tttttttaaa |
7476786 |
T |
|
| Q |
216 |
ataaaaaatatttaaggtgaaggaataatgtcctatgc |
253 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7476785 |
at--aaaatatttaaggtgaaggaataatgtcccatgc |
7476750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University