View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_50 (Length: 255)
Name: NF19438_low_50
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 170
Target Start/End: Original strand, 106851 - 107005
Alignment:
| Q |
16 |
atgaacagcaacgttgtgtgtgtaactggagcttcaggttacatagcttcatggctcgttcgttaccttctccatcgtggttacactgttaaagccaccg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
106851 |
atgaacagcaacgttgtgtgtgtaactggagcttcaggttacatagcttcatggctcgttcgttaccttctccatcgtggttacactgttaaagccaccg |
106950 |
T |
 |
| Q |
116 |
ctcgcgacccaagtaattcattctcttctcttttgatctttataacacaaacact |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
106951 |
ttcgcgacccaagtaattcattctcttctcttttgatctttataacacaaacact |
107005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 166 - 255
Target Start/End: Original strand, 107051 - 107140
Alignment:
| Q |
166 |
acactgaattaattaagtcattgtttaaagttaatgtgtctgcgtctacgtccgtgcttcataagttttgaccctatgtttgatttgatt |
255 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| || ||||| || ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
107051 |
acacttaattaattaagtcattgtttaaagttaatgtgtatgtgtctatgttcgtgcttcatacgttttgaccctatgtttgatttgatt |
107140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 28 - 130
Target Start/End: Original strand, 87493 - 87595
Alignment:
| Q |
28 |
gttgtgtgtgtaactggagcttcaggttacatagcttcatggctcgttcgttaccttctccatcgtggttacactgttaaagccaccgctcgcgacccaa |
127 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||||| || | ||||| |||||||| ||||||||||||||||||| |||||| |||| |
|
|
| T |
87493 |
gttgtgtgtgtgactggcgcttcaggttacatcgcttcatggctcgtccgattgcttcttcatcgtggctacactgttaaagccaccgttcgcgatccaa |
87592 |
T |
 |
| Q |
128 |
gta |
130 |
Q |
| |
|
||| |
|
|
| T |
87593 |
gta |
87595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University