View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_51 (Length: 251)
Name: NF19438_low_51
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_51 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 251
Target Start/End: Complemental strand, 50964184 - 50963940
Alignment:
| Q |
7 |
tcgaagaatatcgtgaacatatgatgctagttttttgaaccctgcacctccttgtttaaaatttctttatggtcaccaatctagctacctacttggacgt |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50964184 |
tcgaaaaaaatcgtgaacatatgatgctagttttttgaaccctgcacctccttgtttaaaatttctttatggtcaccaatctagctacctacttggacgt |
50964085 |
T |
 |
| Q |
107 |
tcaactttcgattaagcaaattatatcgggggtatccaagttcgatcctaactataacaacatctggctaacnnnnnnnagcttccaaccaaactatgaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50964084 |
tcaactttcgattaagcaaattatatcgggggtatccaagttcgatcctaactataacaacatctggctaactttttttagcttccaaccaaactatgaa |
50963985 |
T |
 |
| Q |
207 |
ttttcaatgttttannnnnnngtcgagaaccgaagagttaattac |
251 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
50963984 |
ttttcaatattttatttttttgtcgagaactgaagagttaattac |
50963940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University