View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_55 (Length: 240)
Name: NF19438_low_55
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 32386183 - 32386387
Alignment:
| Q |
18 |
atcaactttttcagttacatattttacctctatgcacacaagtagtaacacttcaatccaataaatatggtcaatagagcaaaacatacagtagttatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32386183 |
atcaactttttcagttacatattttacctctatgcacacaagtagtaacacttcaatccaataaatatggtcaatagagcaaaacatacagtagttatca |
32386282 |
T |
 |
| Q |
118 |
aaaaacaagttaacttactatctccacatagataaatttcctgttcttatcagccaatagagcatgaaccatagaatccaacacattctgaacacaagca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32386283 |
aaaaacaagttaacttactatctccacatagataaatttcctgttcttatcagccaatagagcatgaaccatagaatccaacacattctgcacacaagca |
32386382 |
T |
 |
| Q |
218 |
cccta |
222 |
Q |
| |
|
||||| |
|
|
| T |
32386383 |
cccta |
32386387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University