View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_67 (Length: 223)
Name: NF19438_low_67
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 29068856 - 29069051
Alignment:
| Q |
14 |
cagagacggagtagacggggcgtgcggctatggtgacactcacagagacggttatggcatcaccggtgctgctgctctcagtgagactctctttgtgcgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29068856 |
cagagacggagtagacggggcgtgcggctacggtgacactcacagagacggttatggcatcaccggtgctgctgctctcagtgagactctctttgtgcgt |
29068955 |
T |
|
| Q |
114 |
ggtcagatctgtggcgggtgctttgagctacgatgtctggaagaggatgttccgtttgataagcggtggtgtgtttcgggtagttctgttgttgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29068956 |
ggtcagatctgtggcgggtgctttgagctacgatgtctggaagaggatgttccgtttgataagcggtggtgtgtttcgggtagttctgttgttgtt |
29069051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University