View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19438_low_69 (Length: 219)
Name: NF19438_low_69
Description: NF19438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19438_low_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 59 - 191
Target Start/End: Original strand, 43511554 - 43511686
Alignment:
| Q |
59 |
tggatgagaaaacaaaatatcaaatctttgatatatattaaacaggcagacaagtatatgggtatgtagcaaagattgtagcatgcgagaggtagaagga |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43511554 |
tggatgagaaaacaaaatatcaaatctttgatatatattaaacaggcagacaagtatatgggtatgtagctaagattgtagcatgcgagaggtagaagga |
43511653 |
T |
 |
| Q |
159 |
ttgatgctccgcatttccctaaaaagattgaaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43511654 |
ttgatgctccgcatttccctaaaaagattgaaa |
43511686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University