View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19439_low_3 (Length: 342)
Name: NF19439_low_3
Description: NF19439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19439_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 129 - 312
Target Start/End: Complemental strand, 32062460 - 32062264
Alignment:
| Q |
129 |
gtcaggtgagtttttaaatatgtcctctaactcgtcaatcccttcatcagaaatgaagttaacattaacattcagcaacttaaatccaggtttctggaca |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32062460 |
gtcaggtgagtttttaaatatgtcctttaactcgtcaatcccttcatcagaaatgaagttagcattaacattcagcaacttaaatccaggtttctggaca |
32062361 |
T |
|
| Q |
229 |
acagcttc-------------gcacctgaccatgtgatcaaatttgtactcagatcaacttcacttaattcgtcacgaccttccggcgccttactga |
312 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||| | || |||||||| |||||||||||| |
|
|
| T |
32062360 |
acagcttctgccaacagtttggctcctgaccatgtgatcaaatttgtactcagatcaacttcacttaattggccaagaccttccagcgccttactga |
32062264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 42 - 113
Target Start/End: Complemental strand, 32062522 - 32062451
Alignment:
| Q |
42 |
tcttcagcctcttcatcaatgtcctctccttcaggatcattctcatccaaaggacccagaatgtcaggtgag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32062522 |
tcttcagcctcttcatcaatgtcctctccttcaggatcattctcatccaaaggacccagaatgtcaggtgag |
32062451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University