View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1943_high_4 (Length: 348)
Name: NF1943_high_4
Description: NF1943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1943_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 15 - 329
Target Start/End: Original strand, 47233785 - 47234103
Alignment:
| Q |
15 |
tatactatgtggctttgatgagtttgattaagtacttaatcatcatctaataatctagtaccattagttattttatatttaaatagataggnnnnnnngg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47233785 |
tatactatgtggctttgatgagtttgattaagtacttaatcatcatctaataatctagtaccattagttattttatatttaaatagataggaaaaaaagg |
47233884 |
T |
 |
| Q |
115 |
aaagaagagagttatt----tatatagtaaactcacggcggttaacaaccctttcctcagtaacatgggtggttggtgcagaacgcattgcaatcctatc |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47233885 |
aaagaagagagttattaatttatatagtaaactcacggcggttaacaaccctttcctcagtaacatgggtggttggtgcagaacgcattgcaatcctatc |
47233984 |
T |
 |
| Q |
211 |
gttgcatttgggagtggagctagttcgaatcctatactctggattcatgcagtggctaggtgcctgaagaaaatcaatgaaacaataaagtaaattagta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47233985 |
gttgcatttgggagtggagctagttcgaatcctatactctggattcatgcagtggctaggtgcctgaagaaaatcaatgaaacaataaagtaaattagta |
47234084 |
T |
 |
| Q |
311 |
ccaccaaggaagaagcatc |
329 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47234085 |
ccaccaaggaagaagcatc |
47234103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University