View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1943_low_5 (Length: 397)
Name: NF1943_low_5
Description: NF1943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1943_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 37841954 - 37841719
Alignment:
| Q |
17 |
agggagtaatgtgttct-ggttttgtaataatgatatagaatatttgtagacgtttattttacttgaggaacaaaattgtgttgtacgtttttctcaata |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37841954 |
agggagtaatgtgttcttggttttgtaataatgatatagaatatttgtagacgtttattttacttgaggaacaaaattgtgttgcacgtttttctcaata |
37841855 |
T |
 |
| Q |
116 |
agtagaatgaatttgtattttgtaacnnnnnnngagagaatgaatttgtatttgttctcttctatttacatttctttgttccatgcaactaatttctttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37841854 |
agtagaatgaatttgtattttgtaacaaaaaaagagagaatgaatttgtatttgttctcttctatatacatttctttgttccatgcaactaatttctttc |
37841755 |
T |
 |
| Q |
216 |
ctttcaatcatcatttattctcatacacattactat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37841754 |
atttcaatcatcatttattctcatacacattactat |
37841719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University