View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1943_low_6 (Length: 351)
Name: NF1943_low_6
Description: NF1943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1943_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 292
Target Start/End: Original strand, 40897736 - 40898010
Alignment:
| Q |
17 |
cagtaatgcctgcaagagaagtgcaaacgtcgtggctggcgctagcaacgacgaggctcttgttcatattttttcctctcaacttggtgagtggcctctt |
116 |
Q |
| |
|
||||||||||||| |||||||||| ||| || ||||| |||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
40897736 |
cagtaatgcctgcgagagaagtgcgaacatcatggctagcgctagcaacggcgaggctcttgttcatattttttc-tctcagcttggtgagtggcctctt |
40897834 |
T |
|
| Q |
117 |
tttgtttgatgagtgaggcacacagatgcatttctctccttatggctctaccatctataaatagaaaacctaagacagcaacaagtatcaccaccaacat |
216 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
40897835 |
tttgtttgataagtgaggcacacaaatgcatttctctccttatggctctaccatctataaatagaaaacctaagacagcaacaagtatcattactaacat |
40897934 |
T |
|
| Q |
217 |
tacactcaatagagccaatctcattttcttataactcgcatcaaatccattgcttcgtacagccaaaacatacacc |
292 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| |||||| ||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
40897935 |
tacattcaatagagccaatcccattttcttgtaactcacatcaaatccatttcttggtacagccaaaacattcacc |
40898010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University