View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19440_high_4 (Length: 458)
Name: NF19440_high_4
Description: NF19440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19440_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 18 - 436
Target Start/End: Complemental strand, 44561046 - 44560629
Alignment:
| Q |
18 |
gtttggataattcttgctttataaaagattttctgtagtttttcatggaagacgagttttgtttcttacggcaatttatggtagtccagtggaggggaga |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44561046 |
gtttggataattcttgctttatagaagattttccgtagtttttcatggaagacgagttttgtttcttacggcaatttatggtagtccagtggagggggga |
44560947 |
T |
 |
| Q |
118 |
cctcagaaacattgttggaagtatgcaagaccagtggatgcttgttggcgatttcaatgttgtctcaagatgagaagaaaagcggtgctctagagagcgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44560946 |
cctcagaaacattgttggaagtatgcaagaccagtggatgcttgttggcgatttcaatgttgtctcaagatgagaagaaaggcggtgctctagagagcgt |
44560847 |
T |
 |
| Q |
218 |
ttgaagatgtaggctgttcacggatacaagtgatgctcgcaacctttttgatctctaatttataataatggacctagagtttatgagaggttggatagag |
317 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44560846 |
ttgaagatgtaggctgttcacgg-tacaagtgatgcttgcaacctttttgatctctaatttataataatggacctagagtttatgagaggttggatagag |
44560748 |
T |
 |
| Q |
318 |
atttgagttatgatctttggagaattgatttccctaatggtttagtcaaaactcttcagcaggtggccttttatgatctccgcagcgtgaaaggttttgt |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || || || | ||||| || |
|
|
| T |
44560747 |
atttgagttatgatctttggagaattgatttccctaatggtttagtcaaaactcttctgcaggtggccttttatgatcaccatggcatgcagggtttggt |
44560648 |
T |
 |
| Q |
418 |
tgttgacattacttttcag |
436 |
Q |
| |
|
|||||||| | |||||||| |
|
|
| T |
44560647 |
tgttgacagtccttttcag |
44560629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University