View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19440_low_13 (Length: 259)
Name: NF19440_low_13
Description: NF19440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19440_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 243
Target Start/End: Complemental strand, 43749004 - 43748771
Alignment:
| Q |
12 |
aaaggaggatcaattcggtaaaccgataaaaatatgaagaccaaaactgcaattgatgccacatttgttgcatagagagtagaaacaattactaggctta |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43749004 |
aaaggaggatcaattcggtaaatcgataaaaatatgaagatcaaaactgcaattgatgccacatttgttgcatagagagtagaaacaattactaggctta |
43748905 |
T |
|
| Q |
112 |
tagcttatatcaacataa--nnnnnnncccttcattttgattcactaggaatccaaataaatatatgtttggcactaagtacatgtgcatgttagcatgg |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43748904 |
tagcttatatcaacataatttttttcccccttcattttgattcactaggaatccaaataaatatatgtttggcactaagtacatgtgcatgttagcatgg |
43748805 |
T |
|
| Q |
210 |
ttatgagactcctcttcacaaaggctccaagaac |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43748804 |
ttatgagactcctcttcacaaaggctccaagaac |
43748771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University