View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19440_low_5 (Length: 435)
Name: NF19440_low_5
Description: NF19440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19440_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 4e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 177 - 345
Target Start/End: Complemental strand, 27344525 - 27344357
Alignment:
| Q |
177 |
ggttacattccagattaaaaactttgataacatagagagatgcgccaaatttagccaccgatttcgaatttctatttaatgtataagataagatattgtg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27344525 |
ggttacattccagattaaaaactttgataacatagagagatgcgccaaatttagccaccgatttcgaatttctatttaatgtataagataagatattgtg |
27344426 |
T |
 |
| Q |
277 |
ttctattaaaaatcaaatatttatttatttttcatcgtgcatgtttatgtttgcaatttgtttaatgac |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27344425 |
ttctattaaaaatcaaatatttatttatttttcatcgtgcatgtttatgttttcaatttgtttaatgac |
27344357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 13 - 79
Target Start/End: Complemental strand, 27346086 - 27346020
Alignment:
| Q |
13 |
attctcaaaatgttgaaattaagtgtggtaataacttccaagaagtgccatccaacttggccaataa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27346086 |
attctcaaaatgttgaaattaagtgtggtaataacttccaagaactgccatccaacttggccaataa |
27346020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University