View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19441_high_6 (Length: 205)
Name: NF19441_high_6
Description: NF19441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19441_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 44 - 157
Target Start/End: Original strand, 31168456 - 31168567
Alignment:
| Q |
44 |
gttgttttgttttgtaactctctttgtgttatgaatatttgtttgataagctcatggtatttatagaagtgtgtggatgcatgtgtatacatgggacact |
143 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31168456 |
gttgttttgttttgtaactctct--gtgttatgaatatttgtttgataagctcatggtatttatataagtgtgtggatgcatgtgtatacatgggacact |
31168553 |
T |
|
| Q |
144 |
ctttgaagggagtt |
157 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
31168554 |
ctttgaagagagtt |
31168567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University