View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19442_high_15 (Length: 222)
Name: NF19442_high_15
Description: NF19442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19442_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 35042505 - 35042321
Alignment:
| Q |
14 |
ttattcttatcttggtaatgttctttggtagactcaagaaattcaatatgaatggtggcaaggcatggcacctgtcctagctaacagggtcaaaattctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042505 |
ttattcttatcttggtaatgttctttgggagactcaagaaattcaatatgaatggtggcaaggcatggcacctgtcctagctaacagggtcaaaattctc |
35042406 |
T |
 |
| Q |
114 |
tctatttaattaatatacacttttataatttgaacaaagatagatcaagatcctctatatttcttaggctccaatcacataaatatgaaatt |
205 |
Q |
| |
|
|| || ||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042405 |
tccat----ttaatatacactttt---atttgaagaatgatagatcaagatcctctatatttcttaggctccaatcacataaatatgaaatt |
35042321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 14 - 94
Target Start/End: Complemental strand, 34988943 - 34988863
Alignment:
| Q |
14 |
ttattcttatcttggtaatgttctttggtagactcaagaaattcaatatgaatggtggcaaggcatggcacctgtcctagc |
94 |
Q |
| |
|
|||| ||||| ||||||||||||||||| | ||||||||||||||||||||||||||||| |||||| || ||||||||| |
|
|
| T |
34988943 |
ttatccttattttggtaatgttctttgggatgctcaagaaattcaatatgaatggtggcaaagcatggaacttgtcctagc |
34988863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 15560163 - 15560236
Alignment:
| Q |
19 |
cttatcttggtaatgttctttggtagactcaagaaattcaatatgaatggtggcaaggcatggcacctgtccta |
92 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||| |||||||||||| || ||||| || |||||||||||||| |
|
|
| T |
15560163 |
cttatattggttatgttctttggtaggctcaagagattcaatatgaaaggaggcaaagcctggcacctgtccta |
15560236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 92
Target Start/End: Complemental strand, 15559772 - 15559699
Alignment:
| Q |
19 |
cttatcttggtaatgttctttggtagactcaagaaattcaatatgaatggtggcaaggcatggcacctgtccta |
92 |
Q |
| |
|
||||| ||||| ||||||||||| || ||||||| |||||||||||| || ||||| || |||||||||||||| |
|
|
| T |
15559772 |
cttatattggttatgttctttgggaggctcaagagattcaatatgaaaggaggcaaagcctggcacctgtccta |
15559699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University