View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19443_low_6 (Length: 312)
Name: NF19443_low_6
Description: NF19443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19443_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 296
Target Start/End: Complemental strand, 46260425 - 46260148
Alignment:
| Q |
19 |
ttccacaaccgtatgctaaaccacaagtgcagaaccatggaacccgaatccgctgcggggttctatgttccattctacgttggactcgcagtgggaaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46260425 |
ttccacaaccgtatgctaaaccacaagtgcagaaccatggaacccgaatccgctgcggggttctatgttccattctacgttggactcgcagtgggaaaat |
46260326 |
T |
|
| Q |
119 |
acttatggatgaatacctccaccgcgaaggatcgcgatagtcactgcgaaaagatgttgatatggctgaatgaacaaccgtattacaaagaatcaaacgg |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46260325 |
acttatggatgaacacctccaccgcgaaggatcgcgatagtcactgcgaaaagatgttgatatggcttaatgaacaaccgtattacaaagaatcaaacgg |
46260226 |
T |
|
| Q |
219 |
ttgggatcacttcattacaatggggcgcatcacatgggattttcgtcgttccaaagatgaagattggggttctagttg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46260225 |
ttgggatcacttcattacaatggggcgcatcacatgggattttcgtcgttccaaagatgaagattggggttctagttg |
46260148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University