View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19444_high_39 (Length: 268)
Name: NF19444_high_39
Description: NF19444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19444_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 34660584 - 34660353
Alignment:
| Q |
16 |
attatctcagatgaatgatactttggaaaggaaaattcacctagacattgatggagaaaaatgaatgacaagaaaagtggtccactatgactaccattgc |
115 |
Q |
| |
|
|||||||| ||||||||| |||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34660584 |
attatctctgatgaatgaaacttcggagaagaaaattcacctagacattgatggagaaaaatgaatgacaagaaaagtggtccactatgactaccattac |
34660485 |
T |
 |
| Q |
116 |
agctgcacttagtccttatcactttctcatcaacatgtagttatcatgattttcagtcccaattcttccccaaccacaattgaatgaagttaggacccca |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34660484 |
agctgcacttggtccttatcactttctca---acatgtagttatcatgattttcagtcccaattcttccccaaccacaattgaatgaagttaggacccca |
34660388 |
T |
 |
| Q |
216 |
tgtgttgcaggtgcagaacctaaccatgagatcag |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34660387 |
tgtgttgcaggtgcagaacctaaccatgagatcag |
34660353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University