View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19444_low_41 (Length: 289)
Name: NF19444_low_41
Description: NF19444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19444_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 36 - 269
Target Start/End: Complemental strand, 33321459 - 33321224
Alignment:
| Q |
36 |
gggacacatgaagtcaatggagtgcacatgtcttcttttgattttctgagatcaagatctgactccaataccatcttgagcat--gagaatgcttaaatt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
33321459 |
gggacacatgaagtcaatggagtgcacatgtcttcttttgattttctgagatcaagatctgactccaataccatcttgagcatgagagaatgctcaaatt |
33321360 |
T |
 |
| Q |
134 |
tgtttgtattccttaaaaataattttaaggtggattagnnnnnnnnnnnnnnctcctgctgatttgatcaatcacgccagcagcataactagctggatta |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33321359 |
tgtttgtattccttaaaaataattttaaggtggattagttttttttatttttctcctgctgatttgatcaatcacgccagcagcataactagctggatta |
33321260 |
T |
 |
| Q |
234 |
ttttattggacgacccaccacttgtagagttgcagg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33321259 |
ttttattggacgacccaccacttgtagagttgcagg |
33321224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University