View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19444_low_55 (Length: 226)
Name: NF19444_low_55
Description: NF19444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19444_low_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 88 - 216
Target Start/End: Original strand, 17254044 - 17254172
Alignment:
| Q |
88 |
tagaagtactcataataaccatgttattatccttgagagcactagaacttcttgtgacttgtcgcctagttttagtgacttgagcattctttaacttgtt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
17254044 |
tagaagtactcataataaccatgttattatccttgagagcactagaacttcttgtgacttgtcgcctagttttagttactttagaattctttaacttgtt |
17254143 |
T |
 |
| Q |
188 |
tctataatcttcatcgcttatattcttgg |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
17254144 |
tctataatcttcatcgcttatatttttgg |
17254172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 88 - 136
Target Start/End: Original strand, 17247140 - 17247188
Alignment:
| Q |
88 |
tagaagtactcataataaccatgttattatccttgagagcactagaact |
136 |
Q |
| |
|
|||||||| ||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
17247140 |
tagaagtagtcatagtaaccatgttataatacttgagagcactagaact |
17247188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 173
Target Start/End: Original strand, 17247197 - 17247237
Alignment:
| Q |
133 |
aacttcttgtgacttgtcgcctagttttagtgacttgagca |
173 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
17247197 |
aacttcttctgacttgtcctctagttttagtgacttgagca |
17247237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University