View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19444_low_56 (Length: 225)
Name: NF19444_low_56
Description: NF19444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19444_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 45 - 203
Target Start/End: Original strand, 28496915 - 28497073
Alignment:
| Q |
45 |
tatgaaggacgccaataatactatttaatttataaagttttgtcaattttattagaaattgtttgcacaacgtcagcatgtttgattttgaataacttaa |
144 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28496915 |
tatgaaggacaccaataatactatttaatttataaagttttgtcaattttattagaaattgtttgcacaacgtcagcatgtttgattttgaataacttaa |
28497014 |
T |
 |
| Q |
145 |
tttcaaattttacagaagtagtttttcgtcatataatgggttgcattattggagatgga |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28497015 |
tttcaaattttacagaagtaatttttcgtcatataatgggttccattattggagatgga |
28497073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 45 - 203
Target Start/End: Original strand, 28496170 - 28496329
Alignment:
| Q |
45 |
tatgaaggacgccaataatactatttaatttataaagttttgtcaattttattagaaattgtttgcacaacgtcagcatgtttgattttgaataacttaa |
144 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28496170 |
tatgaaggacgccaataatattatttaatttataaagttttgtcaattttattagaaattgtttgcacaacgtcagcatgtttgattttgtataacttaa |
28496269 |
T |
 |
| Q |
145 |
tttcaaa-ttttacagaagtagtttttcgtcatataatgggttgcattattggagatgga |
203 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28496270 |
tttcaaatttttacagaagtaactttttgtcatataatgggttgcattattggagatgga |
28496329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University