View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19444_low_58 (Length: 223)
Name: NF19444_low_58
Description: NF19444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19444_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 72 - 207
Target Start/End: Complemental strand, 10165530 - 10165395
Alignment:
| Q |
72 |
ccaccttcggtttctttataaaccaaaataactaattaacataaatcaagaaaaataatcaattcccttttttcttcttcatgtaattaaaaaagttatc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10165530 |
ccaccttcggtttctttataaaccaaaataactaattaacataaatcaagaaaaataatcaattcccttttttcttcttcatgtaattaaaaaagttatc |
10165431 |
T |
 |
| Q |
172 |
gcattccataaacaacattttttatgacaacccttt |
207 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10165430 |
gcattccctaaacaacattttttatgacaacccttt |
10165395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University