View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19444_low_62 (Length: 211)

Name: NF19444_low_62
Description: NF19444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19444_low_62
NF19444_low_62
[»] chr6 (1 HSPs)
chr6 (18-198)||(30456191-30456368)
[»] chr3 (2 HSPs)
chr3 (68-138)||(5746106-5746172)
chr3 (68-138)||(5783065-5783131)


Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 30456191 - 30456368
Alignment:
18 caagaggtggtggatcgaatcaaagttct-gcgtggcaatggagtttggatagattgaagatagagacttgtttgttttacgtacgaatggtgttggaat 116  Q
    |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||    ||||||||||||||    
30456191 caagaggtggtggatcaaatcaaagttctagcgtggcaatggagtttggatagattgaagatagagacttgtttattttacg----aatggtgttggaat 30456286  T
117 ccgcgtttttgtttgcgtggctaatccggattatcgttccttggctgttttagagagctatcagttgtagggtgcacaggtt 198  Q
    |||| |||||||||||||||||||||| || ||||||||||||| ||| |||||||||| |||| |||||||||| ||||||    
30456287 ccgcatttttgtttgcgtggctaatccagaatatcgttccttgggtgtgttagagagctgtcagctgtagggtgctcaggtt 30456368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 68 - 138
Target Start/End: Original strand, 5746106 - 5746172
Alignment:
68 agattgaagatagagacttgtttgttttacgtacgaatggtgttggaatccgcgtttttgtttgcgtggct 138  Q
    |||||||| ||||||||||||||||||    || |||||||||||||| || || |||||||||| |||||    
5746106 agattgaatatagagacttgtttgttt----tatgaatggtgttggaaccctcggttttgtttgcatggct 5746172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 68 - 138
Target Start/End: Original strand, 5783065 - 5783131
Alignment:
68 agattgaagatagagacttgtttgttttacgtacgaatggtgttggaatccgcgtttttgtttgcgtggct 138  Q
    |||||||| ||||||||||||||||||    || |||||||||||||| || || |||||||||| |||||    
5783065 agattgaatatagagacttgtttgttt----tatgaatggtgttggaaccctcggttttgtttgcatggct 5783131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University