View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19444_low_62 (Length: 211)
Name: NF19444_low_62
Description: NF19444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19444_low_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 30456191 - 30456368
Alignment:
| Q |
18 |
caagaggtggtggatcgaatcaaagttct-gcgtggcaatggagtttggatagattgaagatagagacttgtttgttttacgtacgaatggtgttggaat |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
30456191 |
caagaggtggtggatcaaatcaaagttctagcgtggcaatggagtttggatagattgaagatagagacttgtttattttacg----aatggtgttggaat |
30456286 |
T |
 |
| Q |
117 |
ccgcgtttttgtttgcgtggctaatccggattatcgttccttggctgttttagagagctatcagttgtagggtgcacaggtt |
198 |
Q |
| |
|
|||| |||||||||||||||||||||| || ||||||||||||| ||| |||||||||| |||| |||||||||| |||||| |
|
|
| T |
30456287 |
ccgcatttttgtttgcgtggctaatccagaatatcgttccttgggtgtgttagagagctgtcagctgtagggtgctcaggtt |
30456368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 68 - 138
Target Start/End: Original strand, 5746106 - 5746172
Alignment:
| Q |
68 |
agattgaagatagagacttgtttgttttacgtacgaatggtgttggaatccgcgtttttgtttgcgtggct |
138 |
Q |
| |
|
|||||||| |||||||||||||||||| || |||||||||||||| || || |||||||||| ||||| |
|
|
| T |
5746106 |
agattgaatatagagacttgtttgttt----tatgaatggtgttggaaccctcggttttgtttgcatggct |
5746172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 68 - 138
Target Start/End: Original strand, 5783065 - 5783131
Alignment:
| Q |
68 |
agattgaagatagagacttgtttgttttacgtacgaatggtgttggaatccgcgtttttgtttgcgtggct |
138 |
Q |
| |
|
|||||||| |||||||||||||||||| || |||||||||||||| || || |||||||||| ||||| |
|
|
| T |
5783065 |
agattgaatatagagacttgtttgttt----tatgaatggtgttggaaccctcggttttgtttgcatggct |
5783131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University