View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_high_30 (Length: 378)
Name: NF19445_high_30
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 4713315 - 4713036
Alignment:
| Q |
1 |
acacacccttcctctatttattcaatatcactcccacactctccaccttaaattgtctttgtgtaacaacttttgttattctcttcacccttcactttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4713315 |
acacacccttcctctatttattcaatatcactcccacactctccaccttaaattgtctttgtgtaacaacttttgttcttctcttcacccttcactttcc |
4713216 |
T |
|
| Q |
101 |
tctgctagagtaaactaccctcaactttt-----gtttcaaacccataatctcaatctcaacttctttgatttcaacaatgtcttgcttagagttagaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4713215 |
tctgctagagtaaactaccctcaacttttaatttgtttcaaacccataatctcaatctcaacatctttgatttcaacaatgtcttgcttagagttagaag |
4713116 |
T |
|
| Q |
196 |
tctctaaagaggttagtataaataatataaaaattacattaccaaatatgtacattatatatttatttattcctcattaa |
275 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4713115 |
tctctaaagaggttagtataaataaaataaaaattacattaccaaatatgtacattatatatttatttattcctcattaa |
4713036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University