View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_high_34 (Length: 360)
Name: NF19445_high_34
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 14 - 341
Target Start/End: Complemental strand, 44554134 - 44553807
Alignment:
| Q |
14 |
tactcaacttcttccgaagacacaaccgaagaaggatctcgaaagaggaagcgaaaatggaaggacttttttgagagaataatgaagaaagtgaccgaga |
113 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44554134 |
tactcgacatcttccgaagacacaacggaagaaggatctcgaaagaggaagcgaaaatggaagaacttttttgagagaataatgaagaaagtgaccgaga |
44554035 |
T |
|
| Q |
114 |
agcaagaggatttgcagaagagattcttggaggttattgagaaacgtgagcaagaacgagttgttagagaagaagcgtggagagcacaagagatgcaaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44554034 |
agcaagaggatttgcagaagagattcttggaggttattgagaaacgcgagcaagaacgagttgttagagaagaagcgtggagagcacaagagatgcaaag |
44553935 |
T |
|
| Q |
214 |
aatcaatagagagagggaaatgcttgcacaagaaagatctataactgcagcaaaagatgctgcagtcatgtctttcttgcaaaaaatagccgaacaacaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553934 |
aatcaatagagagagggaaatgcttgcacacgaaagatctataactgcagcaaaagatgctgcagtcatgtctttcttgcaaaaaatagccgaacaacaa |
44553835 |
T |
|
| Q |
314 |
aatctaggacaagcattacataacatca |
341 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44553834 |
aatctaggacaagcattacataacatca |
44553807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 56 - 313
Target Start/End: Original strand, 12682531 - 12682788
Alignment:
| Q |
56 |
aagaggaagcgaaaatggaaggacttttttgagagaataatgaagaaagtgaccgagaagcaagaggatttgcagaagagattcttggaggttattgaga |
155 |
Q |
| |
|
||||||||| | ||||||||||| || ||||||||| |||||||| | || ||||| |||||||| || || |||||||||||||| | ||| |||| |
|
|
| T |
12682531 |
aagaggaagaggaaatggaaggatttctttgagagactaatgaaggaggttgttgagaaacaagaggagttacataagagattcttggaagctatagaga |
12682630 |
T |
|
| Q |
156 |
aacgtgagcaagaacgagttgttagagaagaagcgtggagagcacaagagatgcaaagaatcaatagagagagggaaatgcttgcacaagaaagatctat |
255 |
Q |
| |
|
|| | || ||| ||| || ||||||||||| ||||| |||||||||||||| || |||||||| |||||||| ||||| ||||| |||||| | |
|
|
| T |
12682631 |
aaagagaaagagagagaggtgcaagagaagaagcttggaggttgcaagagatgcaaaggattaatagagaaagggaaattcttgctcaagagagatctct |
12682730 |
T |
|
| Q |
256 |
aactgcagcaaaagatgctgcagtcatgtctttcttgcaaaaaatagccgaacaacaa |
313 |
Q |
| |
|
|||| | ||||||||||| || ||| |||| ||||| || || || ||||||||| |
|
|
| T |
12682731 |
tgctgctactaaagatgctgctgttatggcttttttgcagaagattgctgaacaacaa |
12682788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University