View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_high_39 (Length: 319)
Name: NF19445_high_39
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_high_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 15 - 300
Target Start/End: Original strand, 32831755 - 32832040
Alignment:
| Q |
15 |
tatcagaatttacagacaaaatcttatcaccagtttgtttgatcaatcactaatcttcatcaagcatggtgaaatcttctacattagtttctttgtccgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32831755 |
tatcagaatttacagacaaaatcttatcaccagttcgtttaatcaatcactaatcttcatcaagcatggtgaaatcttctacattagtttctttgtccat |
32831854 |
T |
|
| Q |
115 |
ttttcgcatttcgtcaatatccacagccaacgacggatcctgtaccagcacattaacatccaacgcctttgggcaacctgacacacagatttgattaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32831855 |
ttttcgcatttcgtcaatatccacagccaacgacggatcctgtaccagcacattaacatccaacgcctttgggcaacctgacacacagatttgattaaaa |
32831954 |
T |
|
| Q |
215 |
accaatgcaatggtggcataaggttaatgtcaaggttatctaaaaacaacatatacccggtattgggcatcgagtgcggtcaccct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| ||| |||||| |
|
|
| T |
32831955 |
accaatgcaatggtggcataaggttaatgtcaaggttatctaaaaacaacatatacccgatattgggcattgagtacggccaccct |
32832040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University